certificate of analysis raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
Reviewed 2025-09-15. Anything still debated is marked as such rather than presented as settled.
Dissolution is usually performed in water or a suitable aqueous buffer, and the resulting liquid is divided into single-use portions before freezing. Freeze-thaw cycling is a recognised source of loss for short peptides, since each cycle can encourage aggregation or adsorption onto container walls. Working solutions are generally kept cold and used within a short window, although published stability data specific to epitalon are thin. Containers should be marked with concentration and date, and solutions examined for cloudiness before use.
Identity is normally established by reversed-phase high-performance liquid chromatography combined with mass spectrometry, a pairing that separates components and confirms molecular mass at once. Purity is quoted as a percentage from the chromatogram, and figures above ninety-five percent are a frequent commercial specification. Amino acid analysis or sequencing supplies further confirmation when required. Because many short peptides behave similarly under chromatography, retention time alone does not establish sequence; the mass measurement is what separates one tetrapeptide from another, and certificates should report both.
Published studies on epitalon are dominated by a small number of research groups, and independent replication in other laboratories remains limited. Proposed mechanisms include activation of telomerase and modulation of melatonin rhythms, but the evidence for either rests mainly on cell cultures and animal models. Whether the peptide produces comparable effects in humans is an open question, and the absence of large controlled trials means the literature is best read as exploratory rather than settled.
Epitalon is a synthetic four-amino-acid peptide with the sequence alanine-glutamate-aspartate-glycine, commonly abbreviated AEDG. Its molecular formula is C14H22N4O9, and its calculated molar mass is approximately 390.35 grams per mole. The compound is a short fragment related to a peptide fraction isolated from bovine pineal gland extracts, and it is normally supplied as a lyophilised powder intended for laboratory research. It is not a registered pharmaceutical product in most countries.
The peptide emerged from research carried out in Saint Petersburg from the late 1980s onward, where investigators searched for shorter active fragments of a pineal preparation known as epithalamin. The name epitalon was chosen to reflect that parent extract. Early reports described effects on neuroendocrine markers and on the lifespan of laboratory animals. Much of that work appeared in Russian-language journals, with English translations following later, which affects how readily the original protocols can be assessed by outside groups.
| Property | Value | Notes |
|---|---|---|
| Sequence | Ala-Glu-Asp-Gly | Written in three-letter amino acid code |
| Single-letter code | AEDG | Form used in most catalogue entries |
| Typical purity specification | 95 percent or higher | Value read from the HPLC chromatogram |
| Storage, dry solid | Minus 20 degrees Celsius, desiccated | Sealed container, protected from light |
| Handling, solution | Divide into single-use portions | Limits losses from freeze-thaw cycling |
Verification of research-grade material involves comparing a supplier chromatogram against an in-house reference, checking the observed mass against the calculated value, and where possible confirming residue order by tandem mass spectrometry or enzymatic peptide mapping. Purity claims should be read alongside the method used to obtain them, because detection wavelength and integration settings alter the result. Batch-specific data, rather than a generic grade statement, is the informative part of a certificate.
Identity and purity of epitalon samples are normally established by reversed-phase high-performance liquid chromatography with ultraviolet detection near 214 nanometres, combined with mass spectrometry. The mass spectrum confirms the expected molecular ion and can reveal truncated or oxidised by-products. Amino acid analysis after acid hydrolysis verifies that the four residues are present in the expected ratio. Certificates typically report a purity figure taken from chromatographic peak area, expressed as a percentage of total integrated signal.
The compound is described in the literature as a derivative of epithalamin, a preparation obtained from bovine pineal tissue. Work on this peptide family was carried out mainly by a research group in Saint Petersburg beginning in the 1980s, and the substance was later registered for clinical use in Russia under the name Epitalon. Outside that region it is generally treated as a research chemical rather than an approved medicine. Statements about its biological activity rest on a relatively small number of studies, and independent replication remains limited.
In its supplied form epitalon is a white to off-white powder, usually lyophilized and often hygroscopic. It dissolves readily in water and in aqueous buffers, and it is commonly handled as the acetate or trifluoroacetate salt to improve stability during purification and drying. The amide backbone is labile in aqueous media, so solutions are less durable than the dry solid. Handling notes in the chemical literature therefore emphasize keeping the powder dry, cool and shielded from light until it is dissolved.
Epitalon is a synthetic tetrapeptide whose sequence is alanine-glutamate-aspartate-glycine, written in single-letter code as AEDG. The four residues are joined by three peptide bonds, giving a linear backbone with no branching and no disulfide bridges. Its calculated molecular mass for the free form is approximately 390.3 daltons, a figure that rises when the compound is supplied as an acetate or trifluoroacetate salt. Because the chain is short, the molecule is defined entirely by its residue order rather than by any folded three-dimensional structure.
The number of IR-observable vibrational modes for some metal carbonyls are shown in the table. Exhaustive tabulations are available. These rules apply to metal carbonyls in solution or the gas phase. Low-polarity solvents are ideal for high resolution. For measurements on solid samples of metal carbonyls, the number of bands can increase owing in part to site symmetry.
=== Marketing === The marketing of the Claritin brand is important in the history of direct-to-consumer advertising of drugs. The first television commercial for a prescription drug was broadcast in the United States in 1983, by Boots. It caused controversy. The federal Food and Drug Administration responded with strong regulations requiring disclosure of side effects and other information. These rules made pharmaceutical manufacturers balk at spending money on ads that had to highlight negative aspects. In the mid-1990s, the marketing team for Claritin at Schering-Plough found a way around these rules. They created brand awareness commercials that never actually said what the drug was for, but instead showed sunny images, and the voiceover said such things as "At last, a clear day is here" and "It's time for Claritin" and repeatedly told viewers "Ask your doctor [about Claritin]." The first ads made people aware of the brand and increased prescriptions, which led Schering-Plough and others to aggressively pursue the advertising strategy. In 1998, a 12-page one-shot comic based on the Batman: The Animated Series was given away to advertise Claritin. The book, written by PRIEST, penciled by Joe Staton, and inked by Mike DeCarlo, sees Tim Drake unable to perform his crime-fighting duties because hay fever and antihistamines make him drowsy. After being given a prescription for Claritin, he saved Batman from Poison Ivy.
1 June – A study shows the clonal diversity of stem cells that produce blood cells gets drastically reduced around age 70 to a faster-growing few, substantiating a novel theory of ageing which could enable healthy aging. 2 June – First success of a clinical trial for a 3D bioprinted transplant, an external ear to treat microtia, that is made from the patient's own cells is reported. 3 June – The NOAA reports that the global concentration of carbon dioxide in Earth's atmosphere is now 50% greater than in pre-industrial times, and is likely at a level last seen 4.1 to 4.5 million years ago, at 421 parts per million (ppm). 5 June – Progress in the treatment of cancer:A very small trial shows complete remission of a type of colorectal cancer without surgery and radiation in all 12 patients. On the same day, results of a trial show that trastuzumab deruxtecan therapy for HER2-low metastatic breast cancer exceeded results from chemotherapy. The synthesis of ERX-41, a novel compound that has shown promise in eliminating cancer cells, is reported (2 June). Researchers describe a new light-activated 'photoimmunotherapy' for brain cancer in vitro. They believe it could join surgery, chemotherapy, radiotherapy and immunotherapy as a fifth major form of cancer treatment (16 June). 6 June – Cats are added to the list of animals that can get SARS-CoV-2 and spread it back to humans, albeit the transmission is considered uncommon and not to be a source of variants of concern since the August 2021 detection.
=== Analytical implementations === Surface plasmon resonance can be implemented in analytical instrumentation. SPR instruments consist of a light source, an input scheme, a prism with analyte interface, a detector, and computer. Any quantitative derivation relies on modelling the surface based on the boundary conditions of the Maxwell's equations, for plane films using the Fresnel equations.
Gram Parsons died from a drug and alcohol overdose on September 19, 1973. He was 26 years old. In the late 1960s, Parsons began to vacation at Joshua Tree National Monument in southeastern California, where he used psychedelics and said he experienced UFO sightings. After splitting from Burrell, Parsons often spent his weekends there with Margaret Fisher and Phil Kaufman. Scheduled to resume touring in October 1973, Parsons decided to go on another recuperative excursion on September 17. Accompanying him were Fisher, his assistant Michael Martin, and Martin's girlfriend Dale McElroy. On both nights of their stay, Parsons retreated to the desert, consuming large amounts of alcohol and barbiturates, while the rest of the group visited bars in nearby Yucca Valley. On September 18, Martin drove back to Los Angeles to resupply the group with marijuana. That night, Parsons challenged Fisher and McElroy to drink with him; Fisher did not drink and McElroy was recovering from illness. Parsons said that he would drink for the three of them and drank six double tequilas. The three then went to the Joshua Tree Inn, where Parsons purchased morphine from an unknown woman; after being injected by her in Room No. 1, he overdosed. Fisher gave Parsons an ice cube suppository, and then a cold shower and moved him to Room No. 8. She put him to bed and went out to buy coffee in the hope of reviving him, leaving McElroy to stand guard. As his breathing became irregular and then ceased, McElroy attempted resuscitation. After all attempts failed, they called an ambulance.
Sources: en.wikipedia.org
Despite challenges faced by the Pakistani film industry, Urdu televised dramas and theatrical performances remain popular, frequently broadcast by many entertainment media outlets. Urdu dramas dominate the television entertainment industry, renowned for their quality since the 1990s. Pakistani music encompasses diverse forms, from provincial folk music and traditional styles like Qawwali and Ghazal Gayaki to modern fusions of traditional and western music. Pakistan boasts numerous renowned folk singers, and the arrival of Afghan refugees in western provinces has sparked interest in Pashto music, despite occasional intolerance.
The word pharmacology is derived from Greek word φάρμακον, pharmakon, meaning "drug" or "poison", together with another Greek word -λογία, logia with the meaning of "study of" or "knowledge of" (cf. the etymology of pharmacy). Pharmakon is related to pharmakos, the ritualistic sacrifice or exile of a human scapegoat or victim in Ancient Greek religion. The modern term pharmacon is used more broadly than the term drug because it includes endogenous substances, and biologically active substances which are not used as drugs. Typically it includes pharmacological agonists and antagonists, but also enzyme inhibitors (such as monoamine oxidase inhibitors).
In signal processing, apodization (from Greek "removing the foot") is the modification of the shape of a mathematical function. The function may represent an electrical signal, an optical transmission, or a mechanical structure. In optics, it is primarily used to remove Airy disks caused by diffraction around an intensity peak, improving the focus.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
== History == Setmelanotide was invented at Ipsen. It was initially known as BIM-22493 and then as RM-493 and IRC-022493. It was evaluated in two one-year clinical studies. The first study enrolled 10 participants with obesity and confirmed or suspected POMC or PCSK1 deficiency while the second study enrolled 11 participants with obesity and confirmed or suspected LEPR deficiency; all participants were six years or older. Most participants had lost more than 10% of their initial body weight after a year of treatment. Some participants also reported feeling less hungry. The U.S. Food and Drug Administration (FDA) granted the application for setmelanotide orphan disease designation, breakthrough therapy designation, and priority review. The FDA granted the approval of Imcivree to Rhythm Pharmaceutical, Inc.
Sources: en.wikipedia.org
Reversed-phase high-performance liquid chromatography is run alongside mass spectrometry. The chromatogram separates components and gives a purity figure, while the mass spectrum confirms that the measured molecular mass matches the expected sequence. Neither measurement on its own is treated as sufficient.
Long-term holding is usually at minus twenty degrees Celsius in a sealed, desiccated container. A refrigerator is adequate for short intervals before use. Light exposure is normally avoided as well. Allowing a cold container to warm before opening reduces moisture condensation on the contents.
Repeated cycles are generally avoided. Each freeze and thaw can promote aggregation or loss of peptide to container surfaces, which reduces the amount available for later work. Dividing a solution into single-use portions at the outset is the usual way to limit this problem.
It is a synthetic tetrapeptide built from alanine, glutamate, aspartate and glycine. The four residues are joined by standard peptide bonds, giving a linear chain rather than a branched structure.