Replicative senescence comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Updated 2026-02-13. Numbers and descriptions here follow the published literature rather than marketing material.
The peptide is a synthetic analogue of epithalamin, a preparation extracted from bovine pineal glands. Investigators sought a short, chemically defined molecule that would reproduce some of the endocrine and gerontological observations attributed to the glandular extract. Proposed mechanisms centre on induction of telomerase activity, an effect reported in cultured human somatic cells in the early 2000s, together with influences on melatonin secretion and neuroendocrine regulation. Those mechanisms remain incompletely characterised, and the reported telomerase response has not been consistently reproduced by independent groups working in comparable systems.
Published work on this compound consists mainly of in vitro experiments, animal studies, and small clinical investigations, a substantial share of which appeared in Russian-language journals. Sample sizes are generally small, control conditions differ between studies, and several endpoints rely on markers whose clinical meaning is itself debated. Reviews of the longevity field treat the peptide as an early example of telomerase-directed research rather than an established intervention. Regulatory treatment varies by country: some jurisdictions place it under prescription controls, others treat it as a laboratory material, and importation may be restricted regardless of local status.
Epitalon is a synthetic tetrapeptide whose sequence is alanine–glutamate–aspartate–glycine, commonly abbreviated AEDG. It was developed in Russia during the 1980s and 1990s by investigators associated with the St. Petersburg Institute of Bioregulation and Gerontology, who studied short peptides as regulators of gene expression and tissue function. The alternative spelling epithalon appears interchangeably in the literature, and the two names refer to the same molecule. Outside Russia it is encountered chiefly as a research chemical rather than a licensed medicine, and it holds no approval from the United States Food and Drug Administration or the European Medicines Agency.
Human data are limited to small studies, often without the randomization, blinding, or control groups expected in contemporary clinical research. Reported outcomes have included changes in melatonin levels, immune markers, and subjective measures, but sample sizes were generally too small to support firm conclusions. Some reviews treat the peptide as promising while noting methodological weaknesses; others question whether the observed effects are specific. The compound is frequently discussed in longevity-focused communities, where enthusiasm often outpaces the published evidence. Separating established findings from speculation is therefore important when reading summaries of this research.
Epitalon emerged from research conducted in Saint Petersburg by Vladimir Khavinson and colleagues, who studied short peptides as potential regulators of aging. The work built on epithalamin, a pineal gland extract reported to influence neuroendocrine function. Epitalon was designed as a synthetic counterpart with a defined sequence, allowing reproducible experiments that extracts could not support. Early publications described effects on melatonin rhythms and lifespan in animal models. These findings circulated mainly in Russian-language journals during the 1990s, which limited their visibility among English-speaking researchers.
The most widely cited claim is that epitalon activates telomerase and thereby extends telomere length. Supporting evidence comes largely from cultured human cells, where treatment was associated with increased telomerase activity and delayed replicative senescence. Telomerase activation is a biologically consequential effect, since the enzyme is largely silenced in most somatic cells. However, the route by which a short peptide would reach and act on the enzyme's regulatory machinery has not been established. Independent replication in human trials is scarce, so the link between cell-culture observations and whole-body aging remains an open question.
| Property | Value | Notes |
|---|---|---|
| Peptide sequence | Ala-Glu-Asp-Gly | Often abbreviated AEDG in research literature |
| Common synonyms | Epithalon, epitalon, AEDG | Spelling variants refer to the same tetrapeptide |
| Molecular formula | C14H22N4O9 | Theoretical monoisotopic mass near 390.35 Da |
| Appearance | White to off-white powder | Typically supplied as a lyophilised solid |
| Solubility class | Freely soluble in water | Hydrophilic peptide; dissolves in aqueous buffer |
Laboratory-grade epitalon is typically supplied as a lyophilized powder. Purity is commonly assessed with reverse-phase high-performance liquid chromatography, often paired with mass spectrometry to confirm molecular identity. Amino acid analysis and peptide mapping can provide additional confirmation of sequence. Certificates of analysis for research materials frequently report purity above 95 percent, although the methods behind such figures vary between suppliers. The absence of a pharmacopeial monograph means that no single standardized assay defines the compound, so reported results depend on the analytical protocol chosen.
Storage recommendations center on limiting moisture, heat, and light. The dry powder is generally kept at minus 20 degrees Celsius, and some suppliers recommend minus 80 degrees for long-term archival. Once dissolved, solutions are usually aliquoted and frozen to avoid repeated freeze-thaw cycles, which can promote aggregation or degradation. Aqueous stability depends on pH and concentration, and buffered saline is often preferred over plain water for biological work. Stability data specific to epitalon remain limited, so general peptide-handling practices are applied by analogy rather than from product-specific validation.
Regulatory treatment differs by country. No formulation of epitalon holds a marketing authorisation as a medicine in the United States or the European Union, where material sold for laboratory use is handled as a research chemical and is not intended for human consumption. In Russia, several short peptide preparations from the same institute's peptide series are registered medicinal products, and epitalon appears in that national context. Elsewhere it is frequently offered as a cosmetic ingredient, a category with lighter requirements. Advertising claims about longevity or disease prevention are restricted in most jurisdictions, which limits how sellers describe the compound.
Freeze-dried epitalon is normally kept at minus twenty degrees Celsius in a sealed, desiccated container, protected from light. Short excursions at ambient temperature during shipping are generally tolerated, but repeated warming and cooling cycles encourage moisture uptake, which shortens shelf life. Once dissolved, the peptide is far less stable than the solid: aqueous solutions are subject to hydrolysis and to deamidation at the aspartate and glutamate residues. Working solutions are therefore held refrigerated and used within days, and repeated freezing and thawing of the same vial is best avoided.
Published evidence comes mainly from Russian-language journals and from a single research group, with small sample sizes and limited independent replication. A few laboratories outside that group have examined related peptides and reported weaker or absent telomerase effects, so the central claim is best described as contested rather than settled. Rodent studies report modest changes in some ageing markers and in survival, but designs vary and control conditions are often sparse. No large randomised trial in humans has been published, and long-term safety data in healthy populations are correspondingly thin.
Epitalon is a synthetic tetrapeptide with the sequence alanine-glutamate-aspartate-glycine, commonly abbreviated AEDG. It was designed at the St. Petersburg Institute of Bioregulation and Gerontology as a short, chemically defined analogue of epithalamin, a fraction obtained from bovine pineal tissue. Small peptide bioregulators of this type formed a long-running line of work there from the 1980s onward. Because the molecule is produced by solid-phase synthesis rather than extraction, its composition is exact and its purity can be measured directly.
== Research related to acupuncture == In December 2001, a study by Langevin and several other researchers at the University of Vermont College of Medicine regarding the "Biomechanical response to acupuncture needling in humans" was published by the peer-reviewed Journal of Applied Physiology, which examined the effects of mechanical tissue stimulation during tissue stretch and during acupuncture.
=== Biomimetics === Many synthetic supramolecular systems are designed to copy functions of biological systems. These biomimetic architectures can be used to learn about both the biological model and the synthetic implementation. Examples include photoelectrochemical systems, catalytic systems, protein design and self-replication.
=== Signs and symptoms === Death caps have been reported to taste pleasant. This, coupled with the delay in the appearance of symptoms—during which time internal organs are being severely, sometimes irreparably, damaged—makes them particularly dangerous. Initially, symptoms are gastrointestinal in nature and include colicky abdominal pain, with watery diarrhea, nausea, and vomiting, which may lead to dehydration if left untreated, and, in severe cases, hypotension, tachycardia, hypoglycemia, and acid–base disturbances. These first symptoms resolve two to three days after the ingestion. A more serious deterioration signifying liver involvement may then occur—jaundice, diarrhea, delirium, seizures, and coma due to fulminant liver failure and attendant hepatic encephalopathy caused by the accumulation of normally liver-removed substances in the blood. Kidney failure (either secondary to severe hepatitis or caused by direct toxic kidney damage) and coagulopathy may appear during this stage. Life-threatening complications include increased intracranial pressure, intracranial bleeding, pancreatic inflammation, acute kidney failure, and cardiac arrest. Death generally occurs six to sixteen days after the poisoning. It is noticed that after up to 24 hours have passed, the symptoms seem to disappear and the person might feel fine for up to 72 hours. Symptoms of liver and kidney damage start 3 to 6 days after the mushrooms were eaten, with the considerable increase of the transaminases. Mushroom poisoning is more common in Europe than in North America.
The following day, Foreign Minister Sihasak Phuangketkeow was named as Bhumjaithai's second candidate for prime minister as a backup. On 25 December, Pheu Thai announced its list of 500 candidates to contest every House seat. Anutin ruled out any coalition between Bhumjaithai and parties seeking to amend Article 112 on lèse-majesté following statements by Natthaphong that the People's Party would never vote for Anutin to become prime minister again. On 26 December, the Democrat Party announced its three candidates for prime minister: party leader Abhisit Vejjajiva, Korn Chatikavanij, and Karndee Leopairote, at its headquarters in Bangkok. Palang Pracharath Party leader Prawit Wongsuwon announced his intention to retire from politics after withdrawing as one of the party's three prime ministerial candidates. His withdrawal as a prime ministerial candidate was joined by deputy party leader Thirachai Phuvanatnaranubala, who also announced his withdrawal from politics. On 28 December, representatives from 52 political parties registered their parties' lists of prime ministerial and party-list candidates.
Their half-lives range from years to millions of years and as alpha emitters they are particularly radiotoxic. While there are proposed – and to a much lesser extent current – uses of all those elements, commercial-scale reprocessing using the PUREX-process disposes of them as waste together with the fission products. The waste is subsequently converted into a glass-like ceramic for storage in a deep geological repository. The duration that radioactive waste must be stored depends on the type of waste and radioactive isotopes it contains. Short-term approaches to radioactive waste storage have been segregation and storage on the surface or near-surface of the earth. Burial in a deep geological repository is a favored solution for long-term storage of high-level waste, while re-use and transmutation are favored solutions for reducing the HLW inventory. Boundaries to recycling of spent nuclear fuel are regulatory and economic as well as the problem of radioactive contamination if chemical separation processes cannot achieve a very high purity. Furthermore, elements may be present in both useful and troublesome isotopes, which would require costly and energy intensive isotope separation for their use – a currently uneconomic prospect. A summary of the amounts of radioactive waste and management approaches for most developed countries are presented and reviewed periodically as part of a joint convention of the International Atomic Energy Agency (IAEA).
Sources: en.wikipedia.org
Tin-121m (121mSn) is a nuclear isomer of tin with a half-life of 43.9 years, making it technically a medium-lived fission product. In a normal thermal reactor, it has a very low fission product yield; thus, this isotope is not a significant contributor to nuclear waste. Fast fission or fission of some heavier actinides will produce it at higher yields. For example, its yield from uranium-235 is 0.0007% per thermal fission and 0.002% per fast fission.
The term "Fearsome Foursome" as applied in professional football in the United States has been used as a nickname for the defensive lines of the New York Giants and Baltimore Colts of the late 1950s in the National Football League (NFL), the San Diego Chargers of the early 1960s in the American Football League (AFL), the Detroit Lions of the early to mid-1960s, and various Los Angeles Rams' defensive lines of the 1960s and 1970s in the NFL. The term has also been used more generically to describe a top team's high performing defensive line. In a 1972 Boston Globe article, a chart of "Famous 'Fearsome Foursomes'" was included that compared the Chargers and Rams who had the Fearsome Foursome nickname, but also included, the 1968 era Green Bay Packers' line, and the defensive lines of the Dallas Cowboys (the "Doomsday Defense"), Minnesota Vikings ("Purple People Eaters"), Kansas City Chiefs and San Francisco 49ers of the 1970s. Sportswriter John Crittenden said in 1975 there had been a dozen defensive lines known as fearsome foursomes.
=== Pregnancy support === Vaginally dosed progesterone is being investigated as potentially beneficial in preventing preterm birth in women at risk for preterm birth. The initial study by Fonseca suggested that vaginal progesterone could prevent preterm birth in women with a history of preterm birth. According to a recent study, women with a short cervix that received hormonal treatment with a progesterone gel had their risk of prematurely giving birth reduced. The hormone treatment was administered vaginally every day during the second half of a pregnancy. A subsequent and larger study showed that vaginal progesterone was no better than placebo in preventing recurrent preterm birth in women with a history of a previous preterm birth, but a planned secondary analysis of the data in this trial showed that women with a short cervix at baseline in the trial had benefit in two ways: a reduction in births less than 32 weeks and a reduction in both the frequency and the time their babies were in intensive care. In another trial, vaginal progesterone was shown to be better than placebo in reducing preterm birth prior to 34 weeks in women with an extremely short cervix at baseline. An editorial by Roberto Romero discusses the role of sonographic cervical length in identifying patients who may benefit from progesterone treatment. A meta-analysis published in 2011 found that vaginal progesterone cut the risk of premature births by 42 percent in women with short cervixes.
The Special Air Service (SAS) is a special forces unit of the British Army. It was founded as a regiment in 1941 by David Stirling, and in 1950 it was reconstituted as a corps. The unit specialises in a number of roles including counter-terrorism, hostage rescue, direct action and special reconnaissance. Much of the information about the SAS is highly classified, and the unit is not commented on by either the British government or the Ministry of Defence due to the secrecy and sensitivity of its operations. The corps consists of the 22 Special Air Service Regiment, which is the regular component, as well as the 21 Special Air Service Regiment (Artists) (Reserve) and the 23 Special Air Service Regiment (Reserve), which are reserve units, all under the operational command of United Kingdom Special Forces (UKSF). Its sister unit is the Royal Navy's Special Boat Service, which specialises in maritime counter-terrorism. Both units are under the operational control of the Director Special Forces. The Special Air Service traces its origins to 1941 during the Second World War. It was reformed as part of the Territorial Army in 1947, named the 21st Special Air Service Regiment (Artists Rifles). The 22nd Special Air Service Regiment, which is part of the regular army, gained fame and recognition worldwide after its televised rescue of all but two of the hostages held during the 1980 Iranian Embassy siege.
Sources: en.wikipedia.org
==== MeSH E05.478.567 – immunoassay ==== MeSH E05.478.567.320 – immunoblotting MeSH E05.478.567.320.200 – blotting, western MeSH E05.478.567.320.200.200 – blotting, far-western MeSH E05.478.567.350 – immunoenzyme techniques MeSH E05.478.567.350.170 – enzyme-linked immunosorbent assay MeSH E05.478.567.350.180 – enzyme multiplied immunoassay technique MeSH E05.478.567.380 – immunosorbent techniques MeSH E05.478.567.380.360 – enzyme-linked immunosorbent assay MeSH E05.478.567.380.810 – radioallergosorbent test MeSH E05.478.567.380.825 – radioimmunoprecipitation assay MeSH E05.478.567.380.830 – radioimmunosorbent test MeSH E05.478.567.639 – radioimmunoassay MeSH E05.478.567.639.405 – immunoradiometric assay MeSH E05.478.567.639.810 – radioallergosorbent test MeSH E05.478.567.639.825 – radioimmunoprecipitation assay MeSH E05.478.567.639.830 – radioimmunosorbent test
Only five stable nuclides contain both an odd number of protons and an odd number of neutrons. The first four "odd-odd" nuclides occur in low mass nuclides, for which changing a proton to a neutron or vice versa would lead to a very lopsided proton-neutron ratio (21H, 63Li, 105B, and 147N; spins 1, 1, 3, 1). The only other entirely "stable" odd-odd nuclide, 180m73Ta (spin 9), is thought to be the rarest of the 251 stable nuclides, and is the only primordial nuclear isomer, which has not yet been observed to decay despite experimental attempts. Many odd-odd radionuclides (such as the ground state of tantalum-180) with comparatively short half-lives are known. Usually, they beta-decay to their nearby even-even isobars that have paired protons and paired neutrons. Of the nine primordial odd-odd nuclides (five stable and four radioactive with long half-lives), only 147N is the most common isotope of a common element. This is the case because it is a part of the CNO cycle. The nuclides 63Li and 105B are minority isotopes of elements that are themselves rare compared to other light elements, whereas the other six isotopes make up only a tiny percentage of the natural abundance of their elements.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Wadden, Thomas A.; Chao, Ariana M.; Machineni, Sriram; Kushner, Robert; Ard, Jamy; Srivastava, Gitanjali; Halpern, Bruno; Zhang, Shuyu; Chen, Jiaxun; Bunck, Mathijs C.; Ahmad, Nadia N.; Forrester, Tammy (2023). "Tirzepatide after intensive lifestyle intervention in adults with overweight or obesity: The SURMOUNT-3 phase 3 trial". Nature Medicine. 29 (11): 2909–2918. doi:10.1038/s41591-023-02597-w. PMC 10667099. PMID 37840095. Wadden, Thomas A.; Chao, Ariana M.; Moore, Molly; Tronieri, Jena S.; Gilden, Adam; Amaro, Anastassia; Leonard, Sharon; Jakicic, John M. (2023). "The Role of Lifestyle Modification with Second-Generation Anti-obesity Medications: Comparisons, Questions, and Clinical Opportunities". Current Obesity Reports. 12 (4): 453–473. doi:10.1007/s13679-023-00534-z. PMC 10748770. PMID 38041774. Wadden, Thomas A.; Brown, Gregory K.; Egebjerg, Christina; Frenkel, Ofir; Goldman, Bryan; Kushner, Robert F.; McGowan, Barbara; Overvad, Maria; Fink-Jensen, Anders (2024). "Psychiatric Safety of Semaglutide for Weight Management in People Without Known Major Psychopathology". JAMA Internal Medicine. 184 (11): 1290–1300. doi:10.1001/jamainternmed.2024.4346. PMC 11372653. PMID 39226070.
=== Fraction collector === The fraction collector is typically a rotating rack that can be filled with test tubes or similar containers. Distribution of the eluate into separate containers are determined by fixed volumes or specific fractions detected at peaks of protein concentration. Many systems include various optional components. A filter may be added between the mixer and column to minimize clogging. In large FPLC columns the sample may be loaded into the column directly using a small peristaltic pump rather than an injection loop. When the buffer contains dissolved gas, bubbles may form as pressure drops where the buffer exits the column; these bubbles create artifacts if they pass through the flow cells. This may be prevented by degassing the buffers, e.g. with a degasser, or by adding a flow restrictor downstream of the flow cells to maintain a pressure of 1-5 bar in the eluant line.
Sources: en.wikipedia.org
Epitalon is a synthetic four-amino-acid peptide with the sequence alanine–glutamate–aspartate–glycine, also written AEDG. It was developed in Russian gerontology research and is studied for proposed effects on telomerase, melatonin regulation, and neuroendocrine function. It is not an approved pharmaceutical in the United States or the European Union.
No. Epithalamin is a peptide-rich extract prepared from bovine pineal glands, while epitalon is a short synthetic peptide designed as a defined analogue of it. The synthetic version was intended to provide a reproducible molecule with some of the same proposed biological activity.
Telomere elongation and telomerase activation have been reported in cultured human somatic cells, but evidence from living human subjects is limited and has not been independently confirmed at scale. Reported findings come largely from small studies with differing designs, so the question remains open rather than settled.
Vladimir Khavinson and colleagues at research institutes in Saint Petersburg developed and studied the peptide. Their program examined short peptides as regulators of aging and neuroendocrine function. Epitalon was one of several compounds produced by that group.